subject
Biology, 22.08.2019 14:00 rachiegonzo7

How much blood does the average person have in their body?

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 20:00
Part a - prefixes, roots, and suffixes match these prefixes, suffixes and roots to their meanings. phospho- angio- -uria -tropic -phag- a. the word root means blood or lymph vessels. b. the word root means urine. c. the word root means feeding or eating. d. the word root means phosphate or phosphorus. e. the word root means attracted specifically to the specified organ or tissue. part b – match these vocabulary terms to their meanings. gonadotropic polyuria angiotensin ii polyphagia phosphodiesterase upon the release of renin, is produced and stimulates vasoconstriction and the release of aldosterone. fsh and lh are examples of hormones, which target the ovaries or testes. an enzyme that degrades second messengers like camp or cgmp is . overproduction of urine, or , is a sign of diabetes mellitus. overeating, or , is a sign associated with diabetes mellitus.
Answers: 2
question
Biology, 21.06.2019 20:30
Prior to the development of dna fingerprinting, blood type could be used to determine possible parentage. although it might prove someone was not a parent, it could not show if someone was positively the parent, only that he or she might be a parent. which of the following is a true statement that can be made about parentage based on blood typing?
Answers: 2
question
Biology, 22.06.2019 05:30
What is the compliment dna strand to the following sequence: ttgactaggcta
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
How much blood does the average person have in their body?...
Questions
question
Mathematics, 25.06.2019 03:30
Questions on the website: 13722361