The enzyme pepsin is produced in the cells of the stomach but not in the cells of the small intestine. The small intestine produces a different enzyme, trypsin. The reason that the stomach and small intestine produce different enzymes is that the gene that codes for pepsin is A) in the cells of the stomach, but not in the cells of the small intestine B) mutated in the small intestine C) digested by the trypsin in the small intestine D) expressed in the stomach but not expressed in the small intestine

Why is excretion necessary to maintain homeostasis?

If a human has 23 pairs of chromosomes in every muscle cell of its body how many chromosomes will be in a human egg or sperm

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?