Now, imagine that a population of tortoises stays in this environment with the higher-up food sources. But another population of tortoises migrates (moves to) a different environment that is covered in dome-shaped rocks. In this environment, it is an advantage to have a dome-shaped shell for camouflage, so the tortoises with the dome-shaped shells have an advantage and are not eaten as much as the tortoises with the other shell shapes. Over time, these two populations gain differences as they are exposed to different environments. The two populations of tortoises are geographically isolated- they are so far apart that they cannot reproduce with each other. Which of the following will most likely occur after many generations of being separated? - They will become separate species.
- Both populations will go extinct.
- One population will die off.
- They will come back together and interbreed.

2. if someone had the list of traits you provided in question 1, do you think he or she would be able to find you in a group of 1000 people? why or why not? if not, what other information encoded in your genes might distinguish you from the others in the group? what are other traits that are encoded for by dna?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

An uncomfortable feeling in the ears when descending in an airplane is caused by changes in air pressure on the: a. inner ear b. middle ear c. eardrum d. hammer/anvil