Which of these is an example of ACTIVE immunity?
A)vaccine
B)antitoxin
C)maternal ant...
Biology, 08.05.2021 03:20 ineedhelpplz40
Which of these is an example of ACTIVE immunity?
A)vaccine
B)antitoxin
C)maternal antibody
D)monoclonal antibody
Answers: 3
Biology, 22.06.2019 11:30
Suppose that on a small island off the coast of scotland, 32 percent of the population has blue eyes, which means that these individuals must be homozygous for the blue eye color gene (bb). the only other eye color found on the island is brown, and individuals that are homozygous for the brown eye color gene (bb) or heterozygous (bb) will have brown eyes because brown is the dominant gene. assume this population is in hardy-weinberg equilibrium. if 100 babies are born next year, how many of these would you expect to have brown eyes and be heterozygous? a. 58 b. 49 c. 29 d. 43
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Mathematics, 12.02.2021 05:00
Mathematics, 12.02.2021 05:00
History, 12.02.2021 05:00
Mathematics, 12.02.2021 05:00
Mathematics, 12.02.2021 05:00
Social Studies, 12.02.2021 05:00
Mathematics, 12.02.2021 05:00
Arts, 12.02.2021 05:00
Mathematics, 12.02.2021 05:00
Mathematics, 12.02.2021 05:00
Mathematics, 12.02.2021 05:00
Mathematics, 12.02.2021 05:00