Write the tRNA sequence for the given strand of mRNA AGGUCAUGCAUGGGCAUGCAU

Which of the following statements is true? a. the main cause for speciation is an increase in gene flow. b. organisms that reproduce asexually are not considered part of a species. c. on a tree of life diagram, speciation is shown by the merging of two different lineages. d.the size of the geographic area inhabited by a population can cause speciation.

Why can't you grow plants with adhesion water?

Molecular models of two different substances are shown below. in the molecule on the left, the oxygen atom pulls on electrons more strongly than the hydrogen atoms. in the molecule on the right, the two oxygen atoms pull on the shared electrons with the same strength. water molecule, h,o oxygen molecule, oz when the two substances are put in the same container, they do not attract each other. why does this happen? a. they both contain oxygen. b. one is polar and one is nonpolar. c . they are both polar. d. they contain different elements.