Biology, 19.05.2021 23:30 bookprincesslol
I don’t understand it, if someone can explain maybe what I have to do and put into each Column or give me the answer either way would help a lot. Thank you.
Answers: 3
Biology, 22.06.2019 03:30
Ayoung boy has been found and police are trying to locate his family they take a dna sample from him and begin collec dna samples from families who have missing children if police use dna samples only from the fathers, which type of dn technology can they use to identify the boy's parent? y-chromosome analysis omtdna (mitochondrial dna) analysis vntrs (variable tandem repeats) o pcr (polymerase chain reaction) analysis
Answers: 1
Biology, 22.06.2019 04:30
Anton created a chart listing different types of materials. which best complete the chart?
Answers: 3
Biology, 22.06.2019 06:30
Zoo geographic regions are characterized by the presence of specific groups of animals these regions are determined by the taxonomic or phylogenetic relationships of animals. the map shows the zoogeographic regions proposed by the naturalist alfred russel wallace in 1876. the similarities of organisms in which two areas numbered above provide the best evidence for common ancestry between the organisms in both locations ?
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
I don’t understand it, if someone can explain maybe what I have to do and put into each Column or gi...
Mathematics, 29.11.2019 03:31
Advanced Placement (AP), 29.11.2019 03:31