![subject](/tpl/images/cats/biologiya.png)
Biology, 25.05.2021 01:10 saintsfan2004
As a rule, the amount of energy that is transferred from one trophic level to the next higher level is about
A. 0%
B. 10
C. 50%
D. 90%
![ansver](/tpl/images/cats/User.png)
Answers: 2
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:00
Which heredity condition causes a buildup of mucus in lungs and pancreas? a. cystic fibrosis b. heart disease c. huntington's disease d. sickle cell anemia
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:30
Chloroplasts and bacteria are in size. a. similar b. at different ends of the size range c. exactly the same d. none of these
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 11:00
Use the above pedigree for questions 1,2, and 3 1. what kind of genetic disorder is represented in the pedigree? a. recessive b. dominate refer to the pedigree in question 1. 2. is the mutated gene in this disorder located on a sex chromosome (x or y) or an autosome? a. sex chromosome b. autosome refer to the pedigree in question 1. 3. which generation has individuals that you are certain are heterozygous for the mutated gene? a. generation 1 b. generation 2 c. generation 3
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
As a rule, the amount of energy that is transferred from one trophic level to the next higher level...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.07.2021 21:10
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.07.2021 21:10
![question](/tpl/images/cats/en.png)
English, 27.07.2021 21:10
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.07.2021 21:10
![question](/tpl/images/cats/mat.png)
Mathematics, 27.07.2021 21:20
![question](/tpl/images/cats/mat.png)
Mathematics, 27.07.2021 21:20
![question](/tpl/images/cats/en.png)
English, 27.07.2021 21:20
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.07.2021 21:20
![question](/tpl/images/cats/mat.png)
Mathematics, 27.07.2021 21:20
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/en.png)
English, 27.07.2021 21:20