When the atmosphere is full of water it can transform from gaseous water into liquid water in as it (4). As the clouds grow they will eventually release the water in the form of (5) - any water that falls from the sky in frozen or liquid form that reaches the ground. Water on the earth then can be transformed from liquid into a gas. This is called (6), and 85% comes from the ocean. Water that instead seeps back into the soil does so through (7), and later evaporates again. Each of these steps is a part of (8), the process of recirculation of water over time.

Anormal appearing couple is found to be heterozygous recessive for albinism both have the genotype aa the gene responsible for albinism is recessive to the normal pigment-producing gene what are the changes of their children being albino

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

How do temperature and salinity affect deepwater currents? they create changes in wind direction, moving denser water in the same direction as the wind and causing the deepwater circulation patterns found in the ocean. as temperatures and salinity levels of water increase, the water rises to the surface where it creates currents as it moves to colder regions. they create density differences that cause dense deepwater currents to flow toward the equator where they displace less dense, warmer water above them. they equalize the forces on undersea currents caused by the coriolis effect as they replace more dense water with less dense water.