subject
Biology, 14.06.2021 22:40 cedarclark9534

In a sewage treatment facility, an optimal environment is maintained for the survival of naturally occurring species of microorganisms. These organisms can then break the sewage down into relatively harmless wastewater. For these microorganisms, the wastewater facility serves as
1.
its carrying capacity
2.
a food chain
3.
an ecosystem
4.
an energy pyramid

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 22:40
In what layer of the sun is energy transfers between atoms
Answers: 1
question
Biology, 21.06.2019 23:10
When elements that form a mineral dissolve in hot water, they form a mixture called a(n) a)geode b)vein c)evaporation d)crystallization e)magma f)lava g)solution h)gem
Answers: 2
question
Biology, 22.06.2019 08:00
Which nucleotide component contains nitrogen
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
In a sewage treatment facility, an optimal environment is maintained for the survival of naturally o...
Questions
question
Computers and Technology, 08.03.2021 21:00
question
Mathematics, 08.03.2021 21:00
question
Mathematics, 08.03.2021 21:00
question
Mathematics, 08.03.2021 21:00
question
English, 08.03.2021 21:00
question
Mathematics, 08.03.2021 21:00
Questions on the website: 13722360