Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

Only the first one (ATG) might coincide with one of the codons before mutation.

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

Only the first one (ATG) might coincide with one of the codons before mutation.

silty loam

hope this