![subject](/tpl/images/cats/biologiya.png)
Biology, 06.07.2021 05:10 Laurenhahahahah
Consider the double-stranded DNA molecule below. The gray segments in the middle represent the regions we’d like to amplify by PCR. Four different pairs of PCR primers (in blue) are shown below. Each primer is shown in the location it would anneal to its template strand. Which primer pair would best amplify the target region?
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 02:40
Which represents the cross between parent plants if one is heterozygous for yellow-colored pods and the other is homozygous for green-colored pods? yy ´ ´ ´ ´ yy
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 06:00
The empty trna moves off and picks up another matching amino acid from the cytoplasm in the cell. the anticodon of the trna, with its attached amino acid, pairs to the codon of the mrna, which is attached to a ribosome. this sequence is repeated until the ribosome reaches a stop codon on the mrna, which signals the end of protein synthesis. the ribosome forms a peptide bond between the amino acids, and an amino acid chain begins to form. when a second trna with its specific amino acid pairs to the next codon in sequence, the attached amino acid breaks from the first trna and is bonded to the amino acid of the second trna.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:30
How does the color of light affect the germination time (amount time a plant takes to develop) of a radish seed?
Answers: 3
You know the right answer?
Consider the double-stranded DNA molecule below. The gray segments in the middle represent the regio...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 26.04.2020 05:59
![question](/tpl/images/cats/es.png)
Spanish, 26.04.2020 05:59
![question](/tpl/images/cats/istoriya.png)
History, 26.04.2020 05:59
![question](/tpl/images/cats/mat.png)
Mathematics, 26.04.2020 05:59
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 26.04.2020 05:59
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 26.04.2020 05:59
![question](/tpl/images/cats/istoriya.png)
History, 26.04.2020 05:59
![question](/tpl/images/cats/health.png)
Health, 26.04.2020 05:59
![question](/tpl/images/cats/mat.png)
Mathematics, 26.04.2020 05:59
![question](/tpl/images/cats/istoriya.png)
History, 26.04.2020 05:59
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
History, 26.04.2020 05:59
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 26.04.2020 05:59