subject
Biology, 21.09.2021 21:50 destinymitchell966

What would be the primary structure of this small protein made from the following DNA sequence?
TACTCTGATAATGCCGTCATT


What would be the primary structure of this small protein made from the following DNA sequence? T

ansver
Answers: 2
Show answers

Another question on Biology

question
Biology, 21.06.2019 17:40
In the family tree below, people with the recessive trait of attached earlobes are shaded gray.
Answers: 1
Answer
question
Biology, 21.06.2019 21:00
What is the relation ship between structure and function in an organism
Answers: 1
Answer
question
Biology, 22.06.2019 01:20
And give a detailed description! scientist observes the boundary between two tectonic plates for a decade and finds that no new volcanoes have formed over the course of her investigation. does this result support the theory of plate tectonics? why or why not?
Answers: 3
Answer
question
Biology, 22.06.2019 03:50
The breakdown of food is accomplished by enzymes. a. physical b. chemical c. mechanical d. none of the above
Answers: 1
Answer
You know the right answer?
What would be the primary structure of this small protein made from the following DNA sequence?
Questions
question
Business, 28.07.2020 19:01
Two mutually exclusive design alternatives are being considered for purchase. Doing nothing is also an option. The estimated cash flows for each alter...
question
Business, 28.07.2020 19:01
Which examples does Phil Gurski give to bridge the gap between analysts and academics (check all that apply)...
question
Business, 28.07.2020 19:01
As the name suggests, convertible bonds allow the owner the option to convert the bonds into a fixed number of shares of common stock. Innovative Ene...
question
Physics, 28.07.2020 19:01
To a very good approximation, we can assume that the air in a room is an ideal gas consisting mostly of nitrogen molecules, with a molecular weight of...
question
Business, 28.07.2020 19:01
Astro Co. sold 20,000 units of its only product and incurred a $50,000 loss (ignoring taxes) for the current year as shown here. During a planning ses...
question
Mathematics, 28.07.2020 19:01
For the function f defined by f(x)=ax2_15,a is a constant and f(3)=10. Which of the following is equal to the value of f(5)?...
question
Mathematics, 28.07.2020 19:01
There are 2 Senators from each of 50 states. We wish to make a 3-Senator committee in which no two members are from the same state. b How many ways ca...
question
Business, 28.07.2020 19:01
identify one popular approach to business strategy where a business seeks ways to bevcome accustomed to its environment...
question
Business, 28.07.2020 19:01
Beck Inc. and Bryant Inc. have the following operating data:. Beck Inc. Bryant Inc. Sales $1,250,000 $2,000,000 Variable costs 750,000 1...
question
Spanish, 28.07.2020 19:01
Lectura del manual “Normas APA séptima edición”. Sólo se leerán los siguientes puntos: Introducción 1. Adaptaciones en español 2. Citación 3. Referenc...
question
Business, 28.07.2020 19:01
One of your employees mentions to you that there is an active grapevine in your organization. Which of the following assumptions can you accurately ma...
question
Mathematics, 28.07.2020 19:01
Which number line represents the solution set for the inequality ...
question
Mathematics, 28.07.2020 19:01
Jamie and Imani each play softball. Imani has won 5 fewer games than Jamie. Is it possible for Jamie to have won 11 games if the sum of the games Iman...
question
English, 28.07.2020 19:01
What significance might these lines of poetry have for Danticat...
question
Business, 28.07.2020 19:01
The valuation of marketable securities on the balance sheet requires the securities on the balance sheet requires the separation of investment securit...
question
Chemistry, 28.07.2020 19:01
The Stork reaction is a condensation reaction between an enamine donor and an ab-unsaturated carbonyl acceptor. The overall reaction three-step sequen...
question
Engineering, 28.07.2020 19:01
Translate the following C code to MIPS. Assume that the variables f, g, h, i, and j are assigned to registers $s0, $s1, $s2, $s3, and $s4, respective...
question
Business, 28.07.2020 19:01
Trade-off Theory. Smoke and Mirrors currently has EBIT of $25,000 and is all-equity financed. EBIT is expected to stay at this level indefinitely. The...
question
Social Studies, 28.07.2020 19:01
The Shanidar 1 Neandertal had an injury that may have caused blindness, arthritic feet, and a missing right forearm. Its anterior teeth were severely...
question
Mathematics, 28.07.2020 19:01
Which of these tables represents a function? ...
More questions: Biology Another questions
Questions on the website: 13722367
See results (0)