Approximately element's occur naturally on earth

In familial hypercholesterolemia individuals homozygous for the allele causing the disorder completely lack receptors on liver cells that take up cholesterol from the blood stream. heterozygous have one-half the number of receptors while individuals homozygous for the normal allele are phenotypically normal. this is an example of a.epistasis b.complete dominance c. incomplete dominance d. codominance

Indicate whether the following statements about the biases in the fossil record are true or false. a) inland species are more likely to be preserved than marine species b) organisms with hard body parts are more likely to be preserved than are those composed soft tissues. c) species that existed over a larger area are more likely to be preserved than species existing over a smaller area. d) organisms that lived very long ago are more likely to be found as fossils than organisms that lived relatively recently e) the fossils of larger organisms are more likely to be found than the fossils of smaller organisms

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?