subject
Biology, 14.10.2021 19:50 needthehelp78

Someone please help!


Someone please help!

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:30
Is becoming less expensive to screen blood samples for dna certain diseases have genetic basis what is possible ethical concern about the availability of inexpensive dna testing
Answers: 1
question
Biology, 23.06.2019 10:00
In evolutionary terms, how old is glycolysis?
Answers: 2
question
Biology, 23.06.2019 11:10
We all have different forms of genes from our parents what are these different forms called? a.alleles b.characters c.dna d.resources
Answers: 2
You know the right answer?
Someone please help!
...
Questions
question
Mathematics, 08.01.2020 03:31
question
Social Studies, 08.01.2020 03:31
Questions on the website: 13722361