Biology, 27.10.2021 14:00 andres2865

1. Which property of water explains how sweet that is released during intense exercise, is capable of regulating the body's physical and chemical
conditions?

Answers: 1

Show answers

Another question on Biology

Biology, 21.06.2019 17:30

What claim did thorne make? what evidence supported his claim?

Answers: 3

Answer

Biology, 22.06.2019 10:30

Apopulation of rabbits live in a local forest. some had a mutation for a large body and long legs. the graph below shows the number of both the mutant and the normal rabbits over 5 generations. which of the following statements is true for this scenario? question 7 options: the rabbits with the mutation were more successful with restricted food than the normal rabbits. both sets of rabbits were equally successful with the restricted food source.i the normal rabbits were more successful with restricted food than the rabbits with the mutation. the graph does not let us know which rabbit was more successful.

Answers: 1

Answer

Biology, 22.06.2019 11:00

What happens as electrons move along the chain of molecules known as the electron transport chain? they gain energy, which causes atp molecules to lose phosphate groups. they gain energy, which causes h *ions to join with oxygen to produce water. they lose energy, which is then used by the cell to make atp. they lose energy, which is then used to break down atp.

Answers: 3

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

1. Which property of water explains how sweet that is released during intense exercise, is capable...

Questions