Biology, 18.11.2021 01:00 bestielove7425
2. a. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the direction (5' and 3') of the two DNA strands. +1 -10 -35 ZPTTGCATCCGAAACGTACGATCGATCGGCCGACT TATTACGATCGGACTACTGCGTCGTAGC5'... ...5AACGTAGGCTTTGCATGCTAGCTAGCCGGCT GAATAATGCTAGCCTGATCACGCAGCATCG3"... (1) Write the first 12 nucleotides of the RNA molecule transcribed from this gene. (1 mark) (Explain why the Start codon does not appear in the first three nucleotides of the sequence transcribed in (i). (1 mark)
Answers: 3
Another question on Biology
Biology, 22.06.2019 06:30
How does the diagram explain ocean currents? earth tilt 23.5 degreesquestion 1 options: earth's tilt causes uneven heating of earth which causes currents.earth's tilt causes the ocean to move because of gravity.earth's tilt and its rotation cause currents.earth's tilt causes uneven distribution of salt which causes currents.
Answers: 1
Biology, 22.06.2019 12:30
Which of the following is a reason why early living organisms on earth could not have survived on the surface? 1. the lack of an ozone layer 2. the lack of oxygen in the atmosphere 3. the fact that these organisms were single-celled
Answers: 1
Biology, 22.06.2019 15:00
Which description shows competition in an environment? an organism that feeds on some food an organism that finds a place to sleep three organisms of the same species living in an area three organisms battling over limited resources
Answers: 3
You know the right answer?
2. a. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the...
Questions
Chemistry, 18.04.2021 01:00
Mathematics, 18.04.2021 01:00
Physics, 18.04.2021 01:00
Mathematics, 18.04.2021 01:00
Biology, 18.04.2021 01:00
Mathematics, 18.04.2021 01:00
Mathematics, 18.04.2021 01:00
Social Studies, 18.04.2021 01:00
