Select all the correct answers. This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The red letters are the noncoding region, and the black letters are the protein coding region.

ATTAGCATACTACGGGC
ATTTGCATACTGACCGGGC
ATTTGCAATACTACCGGGC
ATTTGCAACTACCGGGC
ATGAATGCATACTACCGGGC

Coat color in cats is determined by genes at several different loci. at one locus on the x chromosome, one allele (x ) encodes black fur and another allele (xo) encodes orange fur. females can be black (x x ), orange (xoxo), or a mixture of orange and black called tortoiseshell (x xo). males are either black (x y) or orange (xoy). bill has a female tortoiseshell cat named patches. one night, patches escapes from bill\'s house, spends the night out, and mates with a stray male. patches later gives birth to the following kittens: one orange male, one black male, two tortoiseshell females, and one orange female. what are the genotypes of patches, the stray male, and the kittens?