Answers: 2
Biology, 22.06.2019 04:10
Select the correct answer. tay-sachs disease is caused by a mutation in the hexa gene located on chromosome 15. tay-sachs follows an autosomal recessive pattern of inheritance. with the of the diagram, identify which of the offspring will be an unaffected carrier. a diagram showing the genes of parents who are carriers of tay-sachs disease a. a, b, and c b. b and c c. a and d d. a e. d
Answers: 3
Biology, 22.06.2019 09:30
What type of plant is good for a bioassay and where can i buy it? i only have a month.
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00
The smallest parts of these that retain their original properties are called
Answers: 1
When the stop codon of the translated mRNA enters the , release factors (RFs) alter the peptidyl tr...
Mathematics, 23.02.2020 07:04
Mathematics, 23.02.2020 07:05
Mathematics, 23.02.2020 07:05
History, 23.02.2020 07:07
Mathematics, 23.02.2020 07:08
Mathematics, 23.02.2020 07:10
Mathematics, 23.02.2020 07:13
Mathematics, 23.02.2020 07:14