Biology, 06.12.2021 08:40 sadsociety41
1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' TACATCCGCTTACGTCTGATCGCT 5'
Type of mutation ( 3pts):
Amino acid ( 3pts):
Type of mutation ( 3pts):
2. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' TACGCGCTTACGTCTGATCGCT 5'
Type of mutation ( 3pts):
Amino acid ( 3pts):
Type of mutation ( 3pts):
3. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' 5'
Type of mutation (3pts):
Amino acid ( 3pts):
Type of mutation ( 3pts):
4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' 5'
Type of mutation ( 3pts) :
Amino acid ( 3pts):
Type of mutation ( 3pts):
5. What is the difference between a point mutation and a frameshift mutation? 4pts
Answers: 2
Biology, 22.06.2019 02:00
The idea of spontaneous generation was disproved by in a experiment involving jars of meat
Answers: 1
Biology, 22.06.2019 06:50
Drag the tiles to the correct boxes to complete the pairs. match the nitrogenous base of dna with its complement.
Answers: 3
Biology, 22.06.2019 12:30
Describe the relationship between isotonic solutions, equilibrium, and water movement into and out of a cell.
Answers: 1
Biology, 22.06.2019 13:00
Grade 91.)the gravitational pull from the moon words).2.) what is the rate of gravitational 3.)if you drop a hammer, is it more likely to drop handle side down, head side down, or equal chance that it will land either way? why? 4.)a car moves 60km east and 90km west.a.) what is the distance the car traveled? b.) what is the car's displacement5.)what is the average velocity of a car that moved 60 km south in 3 hours? 6.) a car starts from rest and acceleration to 60 m/s over a time of 5 seconds. what is the acceleration of the car? 7.)what is the speed of an object at rest?
Answers: 1
1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' TACATCCGCTTACGTCTGA...
Geography, 04.03.2021 19:00
Chemistry, 04.03.2021 19:00
Mathematics, 04.03.2021 19:00
Mathematics, 04.03.2021 19:00
English, 04.03.2021 19:00
Mathematics, 04.03.2021 19:00
Computers and Technology, 04.03.2021 19:00
Mathematics, 04.03.2021 19:00
Arts, 04.03.2021 19:00