3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' 5'

Type of mutation (3pts):

Amino acid ( 3pts):

Type of mutation ( 3pts):

4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'

Mutated DNA sequence: 3' 5'

Type of mutation ( 3pts) :

Amino acid ( 3pts):

Type of mutation ( 3pts):

The equation shows cellular respiration. during cellular respiration, glucose combines with oxygen to form carbon dioxide, water, and atp. what happens to the energy in the bonds in glucose? the energy is transferred to oxygen. the energy is transferred to carbon dioxide. the energy is transferred to water. the energy is transferred to atp.