![subject](/tpl/images/cats/biologiya.png)
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 02:00
An example of a trait that would be considered acquired and inherited is a. a cleft chin b. muscle tone c. scar tissue d. freckled skin
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 02:50
Cells destroy body cells infected by a virus or bacteria. killer t t memory t none of the above
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 03:30
Which statement best describes a typical difference that could be found between the "analysis" and "conclusion" sections of a lab report? a) only the "conclusion" describes errors that occurred during the experiment, and only the "analysis" section suggests further research.b) only the "analysis" section includes specific data comparisons, and only the "conclusion" section suggests further research.c) only the "analysis" section discusses whether the original hypothesis was supported, and both sections include graphs of data.d) only the "conclusion section discusses whether the original hypothesis was supported, and both sections suggest further research.(the answer is b i just took the test)
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 04:30
Quick asap will give brainiest ! what best describes the same pattern of tides on earth throughout the day? neap tides spring tides semidiurnal tides nocturnal tides
Answers: 1
You know the right answer?
Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' TACGCGCTTACGTCTGATCGCT...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/User.png)
SAT, 01.08.2019 11:30
![question](/tpl/images/cats/health.png)
Health, 01.08.2019 11:30
![question](/tpl/images/cats/mat.png)
Mathematics, 01.08.2019 11:30
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/geografiya.png)
Geography, 01.08.2019 11:30
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/geografiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 01.08.2019 11:30