subject
Biology, 06.12.2021 19:30 DMarje

Which of the following best describes the process by which magma reaches Earth’s surface during a volcanic eruption? A
Magma builds up in the strata until it is released through the vent crater to form lava.

B
Magma builds up in the vent until it is released through the magma chamber at different strata.

C
Magma builds up in the crater then travels through the strata until it is released through the vent.

D
Magma builds up in the magma chamber then travels through the vent until it is released through the crater.

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 04:00
The transport tubes from food came down the plant are called?
Answers: 1
question
Biology, 22.06.2019 11:30
What would most likely happen if green plants were exposed to longer days of sunlight? a. the mitochondria would produce less energy . b. the chloroplasts would produce more energy. c. the cell wall would become thicker. d. the vacuoles would quickly shrink.b. the chloroplasts would produce more energy.
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 13:00
What is the role of dna ligase in the elongation of the lagging strand during dna replication?
Answers: 1
You know the right answer?
Which of the following best describes the process by which magma reaches Earth’s surface during a vo...
Questions
question
Mathematics, 23.06.2019 18:30
Questions on the website: 13722359