Answers: 2
Biology, 22.06.2019 10:00
Ivan is looking at a cross section of a stem taken from a vascular plant. he sees two different types of vascular tissue: the xylem, which is closer to the center of the stem, and the phloem, located around the xylem, closer to the outside of the stem. how do these two structures work together in a living plant?
Answers: 2
Biology, 22.06.2019 10:00
With regard to enzymes, key is to lock as a) substrate is to activation energy eliminate b) product is to substrate. c) enzyme is to active site. d) substrate is to active site.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00
Suppose you are provided with an actively dividing culture of e. coli bacteria to which radioactive thymine has been added. what would happen if a cell replicates once in the presence of this radioactive base?
Answers: 1
Describe how a gene can be amplified using PCR....
World Languages, 23.09.2019 06:30
Mathematics, 23.09.2019 06:30
Chemistry, 23.09.2019 06:30
Mathematics, 23.09.2019 06:30
Geography, 23.09.2019 06:30
Mathematics, 23.09.2019 06:30
History, 23.09.2019 06:30
History, 23.09.2019 06:30
Mathematics, 23.09.2019 06:30
Spanish, 23.09.2019 06:30