subject
Biology, 15.12.2021 20:40 tamikagoss22

If a strand of DNA looked like TAAGC, what would the complementary DNA strand be?

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 07:00
20 the compound al(nh3)2 has atoms of nitrogen.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:00
How does food concentration affect yeast activity
Answers: 3
question
Biology, 22.06.2019 13:30
Kudzu vines grow by climbing and wrapping around trees. trees covered by kudzu can die because they are starved of sunlight. what type of relationship exists between the trees and the kudzu growing on them?
Answers: 2
You know the right answer?
If a strand of DNA looked like TAAGC, what would the complementary DNA strand be?...
Questions
question
Mathematics, 10.03.2021 21:40
question
Mathematics, 10.03.2021 21:40
question
History, 10.03.2021 21:40
Questions on the website: 13722367