DNA message #2: GAGCGCACCATCGGGAAGCTA
Transcription:
Translation:

Waianapanapa beach in hawaii is a black-sand beach that was formed by waves crashing against volcanic rock. the sand can be very hot on sunny days. which statement best explains why? o a. the black sand has no heat capacity. b. the black sand absorbs no radiation. o c. the black sand is immune to insolation. d. the black sand has a low albedo.

How would you describe the the organisms in the second row of model 1 that are connected to the parents by a line

What advantages does a pedigree have over a written passage?