AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

12) several teeth were found in an area of flat land covered with trees and plants. the teeth were examined by a paleontologist, and it was determined that the teeth came from a shark. they found many other shark teeth in this area. however, the people who discovered the teeth were puzzled, because there was no source of water near where the fossils were found. what is the paleontologist's best explanation for why the teeth were found in this area? a) sharks used to live on flat land. b) this area was once covered with salt water. c) this area was once covered with freshwater. d) someone buried the shark teeth deep in the ground.