Biology, 05.02.2022 18:40 ssargeant2559

All of the following are kingdoms except

Answers: 3

Show answers

Another question on Biology

Biology, 21.06.2019 15:30

Which of these is the most likely consequence of falling petroleum price

Answers: 1

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

Biology, 22.06.2019 20:00

The changes that the students observed, rapid breathing and sweating, would be classified as a to a change in a system.

Answers: 1

Answer

Biology, 22.06.2019 20:50

Suppose a point mutation, such as a change from an adenine to a guanine, occurs in the genome of a human sperm cell. the mutation could occur in any region of a gene. the effect of the mutation on the phenotype of the offspring will be determined by where the mutation occurs and its effect on the final gene product. in which of the following scenarios could the mutation alter the phenotype of the offspring? select all of the scenarios that apply the mutation occurs in the promoter and affects the rate of gene transcription. the mutation results in a new, dominant allele the mutation occurs in a portion of an intron not responsible for exon splicing the mutation occurs in a gene that controls development and alters differentiation of a cell type during development. the mutation occurs in a codon and alters the function of the final protein e mutation occurs in a codon, and the amino acid sequence of the final protein is unchanged.

Answers: 1

Answer

You know the right answer?

All of the following are kingdoms except
...

Questions