![subject](/tpl/images/cats/biologiya.png)
Biology, 16.03.2022 19:20 lilakatedancer
Which of the following describes the proper order in which an egg cell travels during ovulation? (2 points)
Follicle of ovary to uterus
Cervix of ovary to fallopian tube
Follicle of ovary to fallopian tube
Cervix of ovary to uterus
![ansver](/tpl/images/cats/User.png)
Answers: 3
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 13:30
Determine whether the characteristic describe dna replication in prokaryotes only, eukaryotes only, or both prokaryotes and eukaryotes drag each tile to the correct location on the chart
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 05:40
Identify characteristics of energy from the sun. check all that apply. almost all of the energy on earth comes from the sun. energy from the sun is known as mechanical energy. the energy in fossil fuels originally came from the sun. plants convert the energy of sunlight into chemical energy.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 11:00
What is the best conclusion based on this data? the hypothesis was not supported because the data indicated that fertilizing plants does not improve plant growth. the hypothesis was supported; to get the best growth, use 5 milliliters of fertilizer per plant. the hypothesis was not supported; the data indicated that too much fertilizer can inhibit plant growth. the hypothesis was supported; to get the best growth, use 15 milliliters of fertilizer per plant.
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Which of the following describes the proper order in which an egg cell travels during ovulation? (2...
Questions
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 05.05.2020 13:41
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/himiya.png)
Chemistry, 05.05.2020 13:41
![question](/tpl/images/cats/mat.png)
Mathematics, 05.05.2020 13:41
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 05.05.2020 13:41
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/User.png)
![question](/tpl/images/cats/istoriya.png)
History, 05.05.2020 13:41
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/mat.png)