Biology, 09.07.2019 17:00 fgcherubin
The average pea pod contains about 7 peas. the round shape of peas is determined by a dominant allele (r). if heterozygous round pea plants (r/r) are self-fertilized, what proportion of pods in the f1 plants will have all round peas?
Answers: 1
Biology, 22.06.2019 02:30
What evidence supports the law of conservation of energy? a) mechanical energy is converted to chemical energy during photosynthesis. b) oxygen is made from the breakdown of carbon dioxide during photosynthesis. c)energy is absorbed by chlorophyll and becomes chemical energy during photosynthesis. d)the sun gives off light energy that is absorbed by plants.
Answers: 1
Biology, 22.06.2019 05:00
Freckles are a dominant trait in humans. both of the girls have the genotype ff for freckles. if either one marries a man with no freckles, what are the chances that their children will have freckles?
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
The average pea pod contains about 7 peas. the round shape of peas is determined by a dominant allel...
Mathematics, 28.10.2020 01:00
Mathematics, 28.10.2020 01:00
Biology, 28.10.2020 01:00
English, 28.10.2020 01:00
Chemistry, 28.10.2020 01:00
Mathematics, 28.10.2020 01:00
History, 28.10.2020 01:00
History, 28.10.2020 01:00
Biology, 28.10.2020 01:00
Physics, 28.10.2020 01:00
Mathematics, 28.10.2020 01:00
Chemistry, 28.10.2020 01:00
Mathematics, 28.10.2020 01:00