
Biology, 14.02.2023 06:47 kellimcollier896
Which of the following accurately describes what could happen if the Earth stopped spinning?

Answers: 3
Answers

Answer from: Quest
i think it’s c but i might be wrong. if i am let me know! have a good rest of your day as well!

Answer from: Quest
when the displaced particles are perpendicular to the direction the wave travels, is called a transverse wave, whereas in longitudinal wave the displace practices are parallel to the direction of the wave.
in the given image:
first image shows - longitudinal wave
second image shows - transverse wave
third image shows - longitudinal wave
fourth image shows - longitudinal wave

Answer from: Quest
. shsvgd

Answer from: Quest
i'd have to say the answer is probable the second option "the geosphere interacting with the atmosphere"

Another question on Biology

Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1


Biology, 22.06.2019 15:20
Use the numbers to place the companies in order of greatest comparative advantage to least comparative advantage in producing large tubes of toothpaste.
Answers: 3

Biology, 22.06.2019 15:50
The structure of a dna molecule is best described as a. one long strand of nucleic acids b. two strands of dna nucleotides joined by hydrogen bonds c. two strands of amino acids joined by hydrogen bonds d. one long strand of amino acids
Answers: 1
You know the right answer?
Which of the following accurately describes what could happen if the Earth stopped spinning?...
Questions

History, 05.05.2020 00:06

Biology, 05.05.2020 00:06

Mathematics, 05.05.2020 00:06




Mathematics, 05.05.2020 00:06


Mathematics, 05.05.2020 00:07


Physics, 05.05.2020 00:07




Mathematics, 05.05.2020 00:07


Mathematics, 05.05.2020 00:07


Physics, 05.05.2020 00:07