![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 01:30
Plz ! cattle ranchers and dairy farmers rarely allow all of their animals to reproduce instead they practice selective breeding and only encourage the reproduction of animals with specific features. which of the following cows would a dairy farm most likely choose to reproduce? a. a cow that makes a lot of milk. b. a cow that can run quickly. c. a cow with a think, soft fur. d. a cow with large, strong hooves.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 02:00
The phylogenetic tree illustrates the relationship between humans and our closest living relatives. the tree was based on biochemical comparisons, including dna and amino acid sequences. according to the biomolecular data, we could infer that
Answers: 1
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Describe characteristics that are found on plant cells...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 18.10.2020 09:01
![question](/tpl/images/cats/health.png)
Health, 18.10.2020 09:01
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 18.10.2020 09:01
![question](/tpl/images/cats/mat.png)
Mathematics, 18.10.2020 09:01
![question](/tpl/images/cats/es.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 18.10.2020 09:01
![question](/tpl/images/cats/geografiya.png)
![question](/tpl/images/cats/health.png)
Health, 18.10.2020 09:01
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
History, 18.10.2020 09:01
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/nemec.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 18.10.2020 09:01
![question](/tpl/images/cats/mat.png)
Mathematics, 18.10.2020 09:01