Aquatic and marine dead zones can be caused by increases in nitrogen and phosphorus in the water from human waste or fertilizer. these substances encourage algal blooms. although algae produce oxygen in the daytime by photosynthesis, during the night hours they continue to undergo cellular respiration and use up available oxygen. when algal blooms die off, more oxygen is used during decomposition of the dead algal cells. both of these processes can result in a significant depletion of dissolved oxygen in the water, creating dead zones. dead zones can be caused by natural or human factors. a. summarize the role of algal blooms in disrupting the health of aquatic ecosystems.

As a small change in a person's dna can cause a genetic disorder

The equation shows cellular respiration. during cellular respiration, glucose combines with oxygen to form carbon dioxide, water, and atp. what happens to the energy in the bonds in glucose? the energy is transferred to oxygen. the energy is transferred to carbon dioxide. the energy is transferred to water. the energy is transferred to atp.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?