To which of the following dna sequences would the tata box binding protein bind? a. taggcgtatatagcgccttat b. cccgttaattaattaacgcgc c. gcgcttatctattaccgtacg d. atcgattccgatactatgcta

the potatoes have high sugar concentrations and although these potatoes were different we could seethe effects that their sugar concentrations had in different environments. for example, the potatoes in sample a, were placed in pure water. this created a hypertonic environment and caused the potatoes to draw in water from its surroundings. we saw the opposite happen with the potatoes in sample b when placed in the sodium chloride solution. the potatoes in this case were in a hypotonic solution and therefore lost water to their surroundings.