Biology, 07.10.2019 03:30 5nathanomadrid5

As opposed to external fertilization, internal fertilization ensures that
a. all of the sperm will fertilize eggs.
b. sperm and egg will be released simultaneously.
c. the number of sperm and eggs produced will be equal.
d. only the fittest of sperm and egg combinations will survive.
e. sperm will be protected until they can unite with the eggs.

Answers: 1

Show answers

Another question on Biology

Biology, 22.06.2019 03:30

The graph below compares the rates of reaction of a burning candle and an exploding firework. comparing chemical reactions what can you conclude from the graph? the reaction that causes a firework to explode requires less energy to start, and occurs more rapidly than the reaction that causes a candle to burn. the reaction that causes a firework to explode requires less energy to start, and occurs less rapidly than the reaction that causes a candle to burn. the reaction that causes a firework to explode requires more energy to start, and occurs less rapidly than the reaction that causes a candle to burn. the reaction that causes a firework to explode requires more energy to start, and occurs more rapidly than the reaction that causes a candle to burn. mark this and return

Answers: 2

Answer

Biology, 22.06.2019 05:00

Dna. we have heard that we are a product of our dna. but where is it? how do we "get" our dna? it is passed to us, from our parents, but in what form? several vocabulary words associated with inheritance are used interchangeably and sometimes, incorrectly. let's see if you can clear this up for someone just learning about inheritance and cell structure.

Answers: 2

Answer

Biology, 22.06.2019 11:00

Fill in the blank 1. digestion occurs in the small intestine through the action of enzymes. 2. urea, excess water, and other waste materials are eliminated in a water fluid called 3. can cause infections by injecting dna or rna into hosts. 4. the human immune system produces in response to a vaccine, which later can bind to and destroy a pathogen if it invades. 5. are structures that link bone to bone at a joint 6. in the heart, blood flows from the right atrium to the right ventricle, where it is pumped to the the words i can use are: lymphocytes gliding pivot gas urine absorption dermis fulcrum lungs chemical viruses capillary vertebrae esophagus tendons antibodies synapses ligaments kidneys pathogens

Answers: 1

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

As opposed to external fertilization, internal fertilization ensures that
a. all of the sperm...

Questions