Answers: 2
Biology, 22.06.2019 06:00
During the process of two rails or sides break apart and attract new nucleotide bases to form a new and complete strand.
Answers: 2
Biology, 22.06.2019 10:50
Which type of transport is responsible for oxygen entering into blood cells? a. vesicle b.passive c. facilitated d.active b.passive
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00
This is a biological reaction due to a stimulus. i need this quickly !
Answers: 1
What is the primary reason for a difference climate between new york and florida? is it latitude or...
Social Studies, 14.02.2020 20:52
World Languages, 14.02.2020 20:53