subject
Biology, 24.07.2019 01:00 hunteryolanda82

One strand of dna has the base sequence gcattggcagtcatg. write what the strand of mrna would look like

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 22:30
What are the characteristics of living things
Answers: 1
question
Biology, 22.06.2019 08:00
What type of pollution does household garbage cause
Answers: 2
question
Biology, 22.06.2019 09:50
What are characteristics of minerals? select 3 choices
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
One strand of dna has the base sequence gcattggcagtcatg. write what the strand of mrna would look li...
Questions
question
English, 30.06.2019 23:30
question
Social Studies, 30.06.2019 23:30
question
Mathematics, 30.06.2019 23:30
Questions on the website: 13722360