Smooth hair is dominant in horses, and curly hair is recessive. black hair is dominant, and chestnut hair is recessive. if s denotes smooth and s denotes curly, b denotes black and b denotes chestnut, classify the alleles according to their types. 1.homozygous dominant 2.heterozygous 3.homozygous recessive ss bb bb ss bb ss

Determine whether the characteristic describe dna replication in prokaryotes only, eukaryotes only, or both prokaryotes and eukaryotes drag each tile to the correct location on the chart

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Abacteriophage typically attaches to the bacterium and then