Chemistry, 22.05.2020 07:58 200052

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Answers: 2

Show answers

Answers

Answer from: Quest

the density of gold = 19.3 g/cm3

the relation between density and mass and volume is

density = mass / volume

given :

mass of gold = 13 g

density = 13g / volume = 19.3

volume = 13 /19.3 = 0.67 cm^3

thus volume of gold nugget = 0.67 cm^3

Answer from: Quest

Iam not going to tell you

Answer from: Quest

Heat of fusion= heat/mass heat of fusion = 12.03kj/36 g= 0.3342 kj/g or 334.2 j/g

Answer from: Quest

the missing options are :

(1) lower boiling point and a lower freezing point(2) lower boiling point and a higher freezing point(3) higher boiling point and a lower freezing point(4) higher boiling point and a higher freezing point

answer : the correct answer is option (3) higher boiling point and a lower freezing point

explanation :

when a non volatile solute is added to a solvent like water, it results in elevation of boiling point.

let us find the increase in boiling point of water when cacl₂ is added to water to make a solution of 1 m

step 1 : find molality of the solution

let us assume we have 1 l of solution.

$m = \frac{moles (solute)}{l ( solution)}$

$1 m = \frac{moles (cacl_{2})}{1 l }= 1 mol cacl_{2}$

let us convert this to grams of cacl₂.

molar mass of cacl2 is 111 g/mol

grams of cacl₂ = $1 mol \times \frac{111g}{mol} = 111 g cacl_{2}$

mass of solute = 111 g

assuming density of solution same as water which is 1g/ml we have ,

mass of solution = density * volume

mass of solution = $\frac{1g}{ml} \times 1000 ml = 1000 g$

mass of solution = mass of solvent + mass of solute

mass of solute = 1000g - 111g

mass of solute 889 g = 0.889 kg

the molality of the solution can be calculated as

$molality = \frac{mol (solute)}{kg ( solvent)}$

$molality = \frac{1mol}{0.889kg}$

molality = 1.12 m

step 2 : find boiling point elevation.

the elevation in boiling point is calculated as

$\bigtriangleup t_{b} = i \times k_{b} \times m$

here δtb = boiling point elevation

i = vant hoff factor which is the number of ions formed by the solute .

cacl₂ dissociates as $cacl_{2} \rightarrow ca^{2+} + 2 cl^{-}$

it forms 3 ions . therefore,

i = 3

m = molality which is 1.12 m

kb is constant for a given solvent. for water it is 0.512

$\bigtriangleup t_{b} = 3 \times 0.512 \times 1.12$

$\bigtriangleup t_{b} = 1.7$

the boiling point of water increases by 1.7 °c

step 3: find freezing point depression.

when a non volatile solute is added to water, it results in decrease in freezing point.

the formula to find freezing point depression is

$\bigtriangleup t_{f} = i \times k_{f} \times m$

kf is constant for water and its value is 1.86

$\bigtriangleup t_{f} = 3 \times 1.86 \times 1.12$

$\bigtriangleup t_{f} = 6.2$

the freezing point of water decreases by 6.2 °c

therefore we can say that, the solution will have a higher boiling point and a lower freezing point

Another question on Chemistry

Chemistry, 22.06.2019 00:50

If a reactant was removed, did the new equilibrium system shift to make more reactants or more products?

Answers: 1

Answer

Chemistry, 22.06.2019 05:30

Which of the following two events occur to create a sea breeze? select all that apply. warm air rises on the ocean and moves toward the land to cool warm air rises on land and moves toward the ocean to cool cool air moves from the ocean to be warmed by the land cool air moves from the land to be warmed by the ocean

Answers: 3

Answer

Chemistry, 22.06.2019 06:30

Design techniques and materials that reduce the negative environmental impact of a structure are referred to as

Answers: 2

Answer

Chemistry, 22.06.2019 09:10

Select the correct answer from each drop-down menu.describe what happens to a carbon-11 atom when it undergoes positron emission.the decay of a carbon-11 atom _1_, and this causes it to emit _2_.options for 1: > changes a neutron into a proton> changes a proton into a neutron> is hit with a neutron> reconfigures its protons and neutronsoptions for 2: > a negatively charged electron-sized particle> a positively charged election-sized particle> two atoms and several neutrons> two neutrons and two protons

Answers: 3

Answer

You know the right answer?

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Plea...

Questions