Write a python program that converts an input file in fasta format, called
"fasta. txt", to an output file in phylip format called "phylip. txt".
for example if the input file contains:

> human
accgttatac
cgatctcgca
> chimp
acggttatac
cgtacgatcg
> monkey
acctctatac
cgatcgatcc
> gorilla
atctatatac
cgatcgatcg

then the output file should be

human accgttataccgatctcgca
chimp acggttataccgtacgatcg
monkey acctctataccgatcgatcc
gorilla atctatataccgatcgatcg

fasta format has a description (indicated with a '> ') followed by 1 or
more lines of a dna sequence. phylip format has a description followed
by a single line of a dna sequence and each sequence is the same length.
for this homework, the input file will have an arbitrary number of
sequences of arbitrary, but identical, length

In addition to using the icons to adjust page margins, a user can also use

1. technician a says horsepower information can be used by consumers to compare the power of different automobile engines. technician b says that manufacturers will often list the horsepower output of their engines in the online service information. who is right?

Creating "smart interfaces" in all sectors of industry, government, and the public arena is one of the fastest growing hct areas. these interfaces model, interpret, and analyze such human characteristics as speech, gesture, and vision. the field of biometrics, in which humans authenticate themselves to machines, is an area of considerable interest to hct practitioners. fingerprint scans are one of the most frequently used biometric options, and this article, biometric student identification: practical solutions for accountability & security in schools, makes a case for the implementation of fingerprint scans in schools. critique the article, and answer the following questions: according to the author, what are the main benefits of adopting fingerprint scans in schools for student identification? according to the author, what are the main drawbacks of adopting fingerprint scans in schools for student identification? do you agree with the author's assessment of the pl