Mathematics, 30.05.2020 05:02 tyreque

Find the volume of a pyramid with a square base, where the area of the base is
17
ft
2
17 ft
2
and the height of the pyramid is
20.1
ft
20.1 ft. Round your answer to the nearest tenth of a cubic foot.

Answers: 3

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 16:20

He concluded that a heavier object dropped from the same height as a lighter object will land

Answers: 2

Answer

Mathematics, 21.06.2019 17:00

What is the area of the trapezoid shown ?

Answers: 1

Answer

Mathematics, 21.06.2019 23:00

Suppose that 15 inches of wire cost 60 cents. at the same rate, how much (in cents) will 12 inches of wire cost

Answers: 2

Answer

Mathematics, 22.06.2019 01:20

Use pascal's triangle to find the missing values. x4 - 4xb + 6x2 - ax + 1

Answers: 3

Answer

You know the right answer?

Find the volume of a pyramid with a square base, where the area of the base is
17
ft

Questions

Mathematics, 02.07.2019 18:00

Write 44/3 as a whole or mixed number in simplest form.3 2/1414 2/32 3/1414 3/44...

Mathematics, 02.07.2019 18:00

21 pts. what are the intersections of the graphs of these equations with the x-axis? y=0.4x−12...

Mathematics, 02.07.2019 18:00

The table shows the approximate height of a football after it is kicked. tell whether the rates of change are constant or variable...

Chemistry, 02.07.2019 18:00

What does it mean if the plus sign is positive for the sodium atom?...

Mathematics, 02.07.2019 18:00

Sam worked 8.4 hours each day for 7 days. how many hours did he work altogether...

Biology, 02.07.2019 18:00

5' atgcccgggtgtcgtagttga3' complete the complementary sequence for the template strand...

History, 02.07.2019 18:00

Briefly summarize how christianity split into catholicism and protestantism...

Geography, 02.07.2019 18:00

The microscope most commonly used for cell study is called the...

Biology, 02.07.2019 18:00

What are the seven levels of classification...

Mathematics, 02.07.2019 18:00

Identify the type of dilation and find the scale factor...

Mathematics, 02.07.2019 18:00

Gabriella swims 2 laps per minute. what is the unit rate?...

Mathematics, 02.07.2019 18:00

How many numbers can you think of that have 3 tens...

Mathematics, 02.07.2019 18:00

Neha used 4 banana and 5 oranges i her fruit salad. daniel used 7 bananas and 9 oranges. did neha and daniel use the same ratio of bananas to oranges?...

Mathematics, 02.07.2019 18:00

Show me how to solve 384 divided by 55...

Mathematics, 02.07.2019 18:00

Answer if u can will mark brainest show work...

Biology, 02.07.2019 18:00

Semi-permeable structure to contain all of the cell parts and to control what goes and comes out of the cell...

Chemistry, 02.07.2019 18:00

How r nonmetals classified 1st gets brainliest...

Biology, 02.07.2019 18:00

Do trees perform photosynthesis during winter...

Mathematics, 02.07.2019 18:00

Mandie wants to put some lace trim around the outside of a round tablecloth she expanded. the original tablecloth had a radius of 2 ft. and a circumfe...

English, 02.07.2019 18:00

In the pearl, how does juana react when she sees that coyotito’s shoulder, neck, and face are swollen?...

More questions: Mathematics Another questions

Find the volume of a pyramid with a square base, where the area of the base is 17 ft 2 17 ft 2 and the height of the pyramid is 20.1 ft 20.1 ft. Round your answer to the nearest tenth of a cubic foot.

Answers

Another question on Mathematics

Find the volume of a pyramid with a square base, where the area of the base is
17
ft
2
17 ft
2
and the height of the pyramid is
20.1
ft
20.1 ft. Round your answer to the nearest tenth of a cubic foot.