Mathematics, 19.10.2020 14:01 s9227575

34 × (-38) + (-38) × 66 find using suitable properties

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 20:30

Will give let f(x)=2x and g(x)=[tex]2^{x}[/tex] graph the functions on the same coordinate plane. what are the solutions to the equation f(x)=g(x) ? enter your answers in the boxes x=[? ] or x=[? ]

Answers: 1

Answer

Mathematics, 21.06.2019 20:30

Which inequality statement describes the two numbers on a number line? "? 7 and a number 5 units to the right of ? 7"

Answers: 2

Answer

Mathematics, 21.06.2019 21:30

Using the information in the customer order, determine the length and width of the garden. enter the dimensions. length: feet width: feet

Answers: 3

Answer

Mathematics, 21.06.2019 23:30

Solve the equation.then check your solution 8=1.88+a

Answers: 2

Answer

You know the right answer?

34 × (-38) + (-38) × 66 find using suitable properties...

Questions

Mathematics, 22.03.2021 22:00

A cylinder with a radius of 8 yd and a height of 12 yd. Fide the volume and round to the nearest tenth I will give you brainless...

Geography, 22.03.2021 22:00

I’ll mark brainliest if correct! What nation has the United States taken a special interest in due to their massive oil reserves? a. Argentina

Biology, 22.03.2021 22:00

Which state of matter would be described as having low energy, with particles that are fixed in place and their only motion is vibrating? * 1 point

French, 22.03.2021 22:00

Claim 100 pts! and the first to answer gets brainliest!! :)...

Chemistry, 22.03.2021 22:00

Use the balanced "ham sandwich" equation from the concept, repeated below. 2H +C+T +5P + 2B + H2CTP5B2 Which is NOT a possibl...

Mathematics, 22.03.2021 22:00

Imagine that the number 3 button on your calculator is damaged and cannot be used. Use a flowchart to show 4 different ways in which you can calculate...

English, 22.03.2021 22:00

What conclusion can be drawn about infectious diseases, based on this timeline?...

Mathematics, 22.03.2021 22:00

Does anyone know the answer to these? You just answer one or both oh, it's too confusing for me

Chemistry, 22.03.2021 22:00

What are all the intermolecular forces present in a sample of BrF? ion-dipole London Hydrogen bonding dipole-dipo...

Mathematics, 22.03.2021 22:00

What additional information do you need to prove ∆ABC ≅ ∆DEF by the SAS Postulate? A.) ∠CAB ≅ ∠FDE B.) ∠BCA ≅ ∠EFD C.) ∠ABC ≅...

Computers and Technology, 22.03.2021 22:00

Multiple controllers are probably necessary due to the scale of the cloud. Is it beneficial to have system and application controllers? Should the con...

Mathematics, 22.03.2021 22:00

Find the radius of a volume of a sphere that is 4,188.8 cubic feet...

Mathematics, 22.03.2021 22:00

Solve for m: m + 13 = 7 A. m = 20 B. m = -6 C. m = -20 D. m = 6...

Mathematics, 22.03.2021 22:00

Find the values of x and y. ...

Mathematics, 22.03.2021 22:00

Hi I need help pls Due in 10 mins ...

Mathematics, 22.03.2021 22:00

PLS HELP WITH THIS LAST QUEASTION ILL MARK BRAINLIEST I DONT NEED STEP BY STEP JUST THE ANSWER ASAP

Mathematics, 22.03.2021 22:00

Steve is a part of a Goodwill organization that paints houses for people in need. Each house he paints requires 9 and 3/4 cans of paint....

Mathematics, 22.03.2021 22:00

Fully simplify somebody help me please ...

Biology, 22.03.2021 22:00

What is the exons and the intron in this dna strand? ATCTCTTGCCAGATAGTGTGA TACAGAACGGTCTATCACACT...

Mathematics, 22.03.2021 22:00

Make V the subject of the formula A=c/2m(v²-u²)...

More questions: Mathematics Another questions