subject

Mathematics, 19.11.2020 18:20 Geo777

(ANSWER PLZ FOR BRAINLIEST!) A friend needs to make an equivalent ratio to 5/10 and is struggling on how to. Make an equivalent ratio to 5/10 and EXPLAIN to your friend how to make an equivalent ratio!!

ansver

Answers: 3

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 16:30

Solve by any method (graphing, substitution or linear combination)y = x - 82x + 3y = 1a) (2, -6)b) (5, -3)c) (4, -4)d) (0, -8)i figured it out. the answer is (5, -3)

Answers: 1

question

Mathematics, 22.06.2019 00:10

Which of the following expressions cannot be simplified to x – 2?

Answers: 1

question

Mathematics, 22.06.2019 00:30

20 points plus brainliest andwer plus my hover hoard im v desperate ! evaluate the polynomial for x=-2 in the equation -3x^3+7x^2-7x-1 (simplify your answer)

Answers: 1

question

Mathematics, 22.06.2019 01:10

Stefania pours 2 liters of orange juice and 1.5 liters of pineapple juice into a punch bowl. how many liters are in the punch bowl?

Answers: 1

You know the right answer?

(ANSWER PLZ FOR BRAINLIEST!) A friend needs to make an equivalent ratio to 5/10 and is struggling on...

Questions

question

Business, 10.03.2020 08:08

Given the following term structure of risk-free interest rates today, what would you expect the interest rate to be on a two year bond three years fro...

question

Computers and Technology, 10.03.2020 08:08

A(n) is a calculation (using encryption technologies) based on the contents of a disk or file. They are engineered so that even small changes in the...

question

Physics, 10.03.2020 08:08

An airplane speeds down a runway lined by red and green lights as it prepares for takeoff. In the distance, the parallel red and green lights appear t...

question

Social Studies, 10.03.2020 08:08

Many different approaches have been suggested to aid the analyst in identifying a set of candidate objects for the structural model. The four most com...

question

Business, 10.03.2020 08:08

An angry customer has emailed Kurtis wanting to know why the custom luggage he ordered three weeks ago hasn't arrived yet. When Kurtis looks up the or...

question

Biology, 10.03.2020 08:08

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperatur...

question

Business, 10.03.2020 08:08

You own 400 shares of Stock A at a price of $60 per share, 500 shares of Stock B at $85 per share, and 900 shares of Stock C at $25 per share. The bet...

question

Mathematics, 10.03.2020 08:08

Choose the correct problem formulation: A Statistics Department is contacting alumni by telephone asking for donations to help fund a new computer lab...

question

Business, 10.03.2020 08:08

River Thames Insurance Company plans to sell $2,000,000 of euro-commercial paper with a 60-day maturity and discounted to yield 4.60% per annum (assum...

question

Social Studies, 10.03.2020 08:08

Assume that the union wage already exceeds the market-clearing wage. If the union wage is increased, holding other factors constant, then the number u...

question

Business, 10.03.2020 08:08

In which type of operations are you likely to see, at most, only minor variations in the product or service being produced using the same process and...

question

Business, 10.03.2020 08:08

The purpose of is to conceive, analyze, and creatively select channels of communication that will direct advertising messages to the right people in...

question

Physics, 10.03.2020 08:08

In terms of impulse and conservation of momentum, explain why a glass is much more likely to break if it falls onto a cement floor than if it falls on...

question

Business, 10.03.2020 08:08

Unlike manufacturers, buy products from other businesses but do not significantly alter the form of the products they buy before selling them....

question

Biology, 10.03.2020 08:09

C. Which specific biomolecule (lipid, protein, nucleic acid, carbohydrate) is each food mostly made of?...

question

Physics, 10.03.2020 08:10

A mass that weighs 8 lb stretches a spring 6 in. The system is acted on by an external force of 8 sin(8t) lb. If the mass is pulled down 3 in and then...

question

Mathematics, 10.03.2020 08:10

Which best describes how an accretionary wedge forms? Group of answer choices as a result of the accumulation of sediment and oceanic crust being scra...

question

Mathematics, 10.03.2020 08:10

You toss independently a fair coin and you count the number of tosses until the first tail appears. If this number is n, you receive 2n dollars. What...

question

Mathematics, 10.03.2020 08:10

In the xyxyx, y-plane above, the circle has center (h, k)(h, k)(, h, comma, k, )and radius 101010. What is the value of kkk ?...

question

Business, 10.03.2020 08:10

Chuck believes that his business has grown because of his personal involvement in every step of the way. What advice do you offer Chuck as he continue...

More questions: Mathematics Another questions

Questions on the website: 13722362