subject
Mathematics, 12.02.2021 14:00 dudejustdont

The Triple L investment club is considering purchasing a certain stock. After considerable research the club members determine that there is a 50% chance of making $85,000, a 35% chance of breaking even, and a 15% chance of losing $140,000. Find the expected value of this purchase.

ansver
Answers: 1
Show answers

Another question on Mathematics

question
Mathematics, 21.06.2019 14:50
Which expression is equivalent to 5r6141 2r+st6
Answers: 1
Answer
question
Mathematics, 21.06.2019 19:00
What is the expression in factored form? -20x^2 - 12x a. 4x(5x+3) b. -4x(5x-3) c. -4(5x+3) d. -4x(5x+3)
Answers: 2
Answer
question
Mathematics, 21.06.2019 21:30
A(1,1) b(-3,0) c(-4,-1) d(3,-2) drag it to correct position
Answers: 2
Answer
question
Mathematics, 21.06.2019 23:00
Delbert keeps track of total of the total number of points he earns on homework assignments, each of which is worth 60 points. at the end of the semester he has 810 points. write an equation for delbert’s average homework score a in terms of the number of assignments n.
Answers: 3
Answer
You know the right answer?
The Triple L investment club is considering purchasing a certain stock. After considerable research...
Questions
question
Mathematics, 25.12.2021 09:00
The ratio of athletes in the two teams is 3:2. After 12 athletes move from first team to second, the ratio is 5:4. Find the number of athletes on each...
question
Business, 25.12.2021 09:00
According to the principles of scientific management, the best way to improve productivity is to...
question
Mathematics, 25.12.2021 09:00
Jade recorded how many characters she used in each of her 9 most recent text messages. Here's a histogram showing her data: # of message...
question
Mathematics, 25.12.2021 09:00
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' 5' Type of mutation (3pts): Amino acid ( 3pts...
question
Social Studies, 25.12.2021 09:00
In order to classify information the information must concern...
question
SAT, 25.12.2021 09:00
A tuna salad was removed from refrigeration and served at a picnic....
question
Computers and Technology, 25.12.2021 09:00
which keyboard shortcut can you use to access the go to feature, which will allow you to move quickly to another location in the document without havi...
question
SAT, 25.12.2021 09:00
Which of the following costs of publishing a book is a fixed cost?....
question
SAT, 25.12.2021 09:00
Euglena and several other protists that use their cilia or flagella to move around and gather food are classified along with the plant-like protists....
question
History, 25.12.2021 09:00
The excerpt makes the overall argument that the atlantic economy...
question
Mathematics, 25.12.2021 09:00
the total cost of a watch and a radio is rs 500 .If the watch is cheaper than the radio by rs 150,find their cost...
question
Business, 25.12.2021 09:10
We can say that the allocation of resources is efficient if...
question
SAT, 25.12.2021 09:10
Explain why the terza rima form is especially appropriate for "ode to the west wind"....
question
Business, 25.12.2021 09:10
e. The price at which Smitten would earn a normal profit is where multiple choice marginal cost equals average cost at the minimum of average cost. ma...
question
Social Studies, 25.12.2021 09:10
When Mary thinks about a guitar, she uses a mental representation of specific knowledge about that object. Mary is thinking about a...
question
Chemistry, 25.12.2021 09:10
Some glucose produced by gluconeogenesis is stored in the body as glycogen. Order the steps of glycogen synthesis. a. Glycogen phosphorylase phospho...
question
Business, 25.12.2021 09:10
How much money can Barry and Mary gift to their grandchildren in 2019 without any gift tax liability...
question
Social Studies, 25.12.2021 09:10
Which two ideas does the phrase "nostalgia had a powerful allure" suggest about the townspeople's attitude toward the toy store?...
question
Mathematics, 25.12.2021 09:10
Item at position 5 The AIME Triathlon consists of a half-mile swim, a 30-mile bicycle ride, and an eight-mile run. Tom swims, bicycles, and runs at co...
question
Biology, 25.12.2021 09:10
People more quickly recognize that a dog is a mammal than that a whale is a mammal because a dog more closely resembles their of a mammal....
More questions: Mathematics Another questions
Questions on the website: 13722367
See results (0)