Mathematics, 16.02.2021 02:10 archersmithdrag

Find the equation of the line.
Use exact numbers.
y=x+

Find the equation of the line.
Use exact numbers.
y=__x+__

Answers: 2

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 13:30

Gabriel paints flower pots to sell at a craft fair. she paints 2/5 of a flower pot teal, 1/4 of it yellow, and the rest of it white. what fraction of the pot is painted either teal or yellow?

Answers: 3

Answer

Mathematics, 21.06.2019 21:30

With number 11 ( show how you got the answer)

Answers: 1

Answer

Mathematics, 21.06.2019 22:00

If tan2a=cot(a+60), find the value of a, where 2a is an acute angle

Answers: 1

Answer

Mathematics, 21.06.2019 22:50

What is the ordered pair of m’ after point m (5, 6) is rotated 90° counterclockwise?

Answers: 2

Answer

You know the right answer?

Find the equation of the line.
Use exact numbers.
y=__x+__
...

Questions

Chemistry, 20.07.2019 06:00

What phase change occurs during evaporation?...

Mathematics, 20.07.2019 06:00

What is the value of x in the solution to this system of linear equations? 4x - 3y = 3...

English, 20.07.2019 06:00

Which of the following is true about the mayflower compact? a. the colony would be based on church of england beliefs. b. it created the massachusett...

Biology, 20.07.2019 06:00

Pl find mrna and a. a sequnce to this sickle cell hemoglobin dna- cacgtggactgaggacacctc sickle cells hemglobin mrna- sickle cell shemoglobin a. a s...

History, 20.07.2019 06:00

The dust bowl described what great depression situation?...

History, 20.07.2019 06:00

True or false while in school at jerusalem paul may have stayed at the home of his married sister...

Biology, 20.07.2019 06:00

Which step happens first in dna replication? a. protein is formed from the dna. b. base pairs are broken apart. c. the replication fork forms. d. the...

Mathematics, 20.07.2019 06:00

The average person drinks one pint of milk a day at this rate how many gallons will a person drink in 366 days...

Mathematics, 20.07.2019 06:00

Jerry is a judge. he hears 555 cases every 2 3/8. jerry hears cases at a constant rate. how many cases does he hear per hour?...

History, 20.07.2019 06:00

What do you think is the most important aspect of social studies that is used to define humans and their societies? are there any subject areas that...

English, 20.07.2019 06:00

What is the purpose of “the declaration of sentiments”? what viewpoint does it convey about women’s rights? how does the structure to convey the pu...

History, 20.07.2019 06:00

What divided the eastern and western europe after ww2...

English, 20.07.2019 06:00

Would someone answer this question will be and also will pick ( be honest)...

Mathematics, 20.07.2019 06:00

Acoach purchases 47 hats for his players and their families at a total cost of $302. the cost of a small hat is $5.50. a medium hat costs $6.00. a lar...

Chemistry, 20.07.2019 06:00

What is this kind of acid bases reaction called...

History, 20.07.2019 06:00

Read the statement from emerson's "self-reliance," and then answer the question. "power ceases in the instant of repose; it resides in the moment of...

English, 20.07.2019 06:00

Give examples from romeo and juliet...

Biology, 20.07.2019 06:00

Normal hemoglobin dna - cacgtggactgaggactcctc what is the normal hemoglodin acid- normal hemoglobin a. a sequnce for figuring out rna a binds with...

History, 20.07.2019 06:00

The event that started the migration of many cubans to florida was a. a severe drought. b. the cuban missile crisis. c. the cuban revolution. d. a des...

English, 20.07.2019 06:00

Consider the complex character tajima shume in “tajima.” how do tajima’s actions and interactions advance the plot and develop a theme in the story?...

More questions: Mathematics Another questions

Find the equation of the line. Use exact numbers. y=__x+__

Answers

Another question on Mathematics

Find the equation of the line.
Use exact numbers.
y=x+