subject

Mathematics, 26.03.2021 21:50 gtrsoccer

Make a histogram from this frequency table. 8- 10-12 12-14 14-16 NBA Shoe Sizes Frequency 10 3 5 10 8

ansver

Answers: 3

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 16:30

Pete is making decorations for a dinner party. the instructions tell him to use 9 flowers for a medium-sized decoration. complete each statement to adjust the flowers for different-sized decorations based on these instructions.

Answers: 3

question

Mathematics, 22.06.2019 00:30

Describe how to translate the graph of y=/x to obtain the graph of y=/x+5

Answers: 2

question

Mathematics, 22.06.2019 01:30

Talia grouped the terms and factored out the gcf of the groups of the polynomial 15x2 – 3x – 20x + 4. her work is shown below. (15x2 – 3x) + (–20x + 4) 3x(5x – 1) + 4(–5x + 1) talia noticed that she does not have a common factor. what should she do?

Answers: 1

question

Mathematics, 22.06.2019 03:00

Which equation represents h in the triangle? a) h = 6sin37° b) h = 10sin37° c) h = 6 10 sin37° d) h = 10 6 sin37°

Answers: 1

You know the right answer?

Make a histogram from this frequency table. 8- 10-12 12-14 14-16 NBA Shoe Sizes Frequency 10 3 5 10...

Questions

question

Mathematics, 22.01.2021 04:00

Can someone help plz im giving brain ...

question

English, 22.01.2021 04:00

Describe how the use of voice helps develop the mood of The Diary of a Young Girl. Now that you have had a chance to read excerpts from Anne Frank’s...

question

English, 22.01.2021 04:00

Read the letter to the editor “I, Too, Have a Dream.” How does the writer use structure and language to persuade her readers and support her feelings...

question

Biology, 22.01.2021 04:00

The is the site where lipids, triglycerides, and steroids are synthesized, as well as where calcium is stored within the cell. The is the site where...

question

Biology, 22.01.2021 04:00

Scientists have found that the fungus Penicillium brefeldianum produces a toxin known as Brefeldin A (BFA), which is able to block transport from the...

question

Mathematics, 22.01.2021 04:00

Select all angles adjacent to 24. You must select all correct answers. A. 1 B. 2 C. 3 D. 4

question

Chemistry, 22.01.2021 04:00

1. While in outer space a rocket engine is able to produce thrust on a spacecraft. Identify the correct action-reaction pair which allows the spacecr...

question

Mathematics, 22.01.2021 04:00

Help with #12 please ...

question

Mathematics, 22.01.2021 04:00

The slope of the line shown in the graph is? And the y-intercept of the line is?

question

History, 22.01.2021 04:00

12. One reason California achieved statehood earlier than other territories in the American Southwest was...

question

Mathematics, 22.01.2021 04:00

A wire is bent to form four semicircles. How long is the wire to the nearest hundredth?

question

English, 22.01.2021 04:00

An important character is called A. a major character. B. a minor character. C. a round character....

question

Biology, 22.01.2021 04:00

DNA: GTACGCGTATACCGACATTC mRNA: Codon: Anitcodon: Amino Acids:...

question

History, 22.01.2021 04:00

How do you think the world would be different today if Spain had successfully invaded and conquered England in 1588?...

question

Mathematics, 22.01.2021 04:00

It rained 1.01 inches, but 0.018 of the rain evaporated, how much rain would be left?...

question

Arts, 22.01.2021 04:00

How do I make Artist statement unique?...

question

Mathematics, 22.01.2021 04:00

What is the value of x? ...

question

Mathematics, 22.01.2021 04:00

Select the correct answer from the drop-down menu. (18)-2 Consider the expression (3y)2.-5. The equivalent simplified form of this expres...

question

English, 22.01.2021 04:00

I will give 33 points plus the other ones that are the same are 60 In the mocking bird Chapter 1, Scout presents much of what she “knows" about Boo R...

question

Mathematics, 22.01.2021 04:00

I need help solving this please ...

More questions: Mathematics Another questions

Questions on the website: 13722360