Mathematics, 13.10.2019 03:10 tttyson

What is the correct way of evaluating 30b+12b for b=5

Answers: 3

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 19:00

2pointswhich of the following appear in the diagram below? check all that apply.d a. zcdeов. сеo c. aéo d. zdce

Answers: 1

Answer

Mathematics, 21.06.2019 20:40

In a 45-45-90 right triangle, what is the ratio of the length of one leg to the length of the other leg? а . 1: 2 в. 2: 1 с. 2: 1 d. 1: 1

Answers: 1

Answer

Mathematics, 21.06.2019 23:50

If np3 /nc2 = 6, find the value of n

Answers: 2

Answer

Mathematics, 22.06.2019 00:00

What expression is equivalent to (84+16)

Answers: 1

Answer

You know the right answer?

What is the correct way of evaluating 30b+12b for b=5...

Questions

English, 04.10.2020 18:01

What is not an example of nonfiction? newspaper biography novel directions...

Geography, 04.10.2020 18:01

Why is a political map more likely to change than a physical map...

Chemistry, 04.10.2020 18:01

I NEED HELP ASAP PLEASE ...

History, 04.10.2020 18:01

Which of the following rights is guaranteed by the first amendment? A. freedom to assemble B. trial by a jury of peers C. no self-incrimi...

Social Studies, 04.10.2020 18:01

A government where power rests with the religious leaders....

Chemistry, 04.10.2020 18:01

The boy and the bottle chemistry...

Spanish, 04.10.2020 18:01

Read and choose the best words or expressions that connect to the image. A backpack El lápiz La pluma El cuaderno La mochila...

Mathematics, 04.10.2020 18:01

Mr. Smith is making $25 and hour before his boss gives him a 10% raise. How much will his new hourly wage be? $25.10 $27.50 $50.00...

Chemistry, 04.10.2020 18:01

1s22s22p63s 3p645230104p5 Which element is this? fluorine (F) bromine (Br) chlorine (Cl) krypton (Kr)...

Health, 04.10.2020 18:01

WILL GIVE BRAINLIEST IF ANSWERED CORRECTLY Egg shells are permeable and will a. protect the egg from bacteria. b. add many n...

English, 04.10.2020 18:01

We lived there for three days - Mother and we five children, the youngest of whom was three years old. Because of the rigorous physical examination th...

Mathematics, 04.10.2020 18:01

The formula for distance traveled dis d = rt, where r is the average speed of the object and t is time traveled. If an object travels 75 meters in 30...

History, 04.10.2020 18:01

According to the Population Density map (p. 107), what is the area of greatest population density found in Canada? Select one a. Near Alaska b. Near G...

Mathematics, 04.10.2020 18:01

Which rule describes the composition of transformations that maps ΔBCD to ΔB"C"D"? Translation of 5 units x, negative 6 units y composition reflection...

Mathematics, 04.10.2020 18:01

Emily bought forty eight crayons that came in packs of 4. How many packs of crayons did dan buy?...

Mathematics, 04.10.2020 18:01

Physics, 04.10.2020 18:01

Suppose a force of N is required to stretch and hold a spring m from its equilibrium position. a. Assuming the spring obeys Hooke's law, find the spri...

Biology, 04.10.2020 18:01

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?...

Computers and Technology, 04.10.2020 18:01

The process of determines what volume a system can handle by comparing its performance to standards in the industry....

Mathematics, 04.10.2020 18:01

7. There are 1000 different components in the system that your department has just designed. The objective is that for each of the systems that you de...

More questions: Mathematics Another questions