Mathematics, 30.06.2019 16:00 corrineikerd

Find the y-intercept of the function y=-2/3(x-1)+7.

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 15:30

For what is the measure of the angle at the top of the shed? a. multiplication of areas b. squaring of areas c. addition of areas d. division of areas

Answers: 1

Answer

Mathematics, 21.06.2019 22:00

Find the value of x in each case. give reasons to justify your solutions! d q ∈ pr

Answers: 3

Answer

Mathematics, 22.06.2019 02:00

During how many months was the difference between the number of days with homework and with no homework greater than 6?

Answers: 1

Answer

Mathematics, 22.06.2019 02:10

If point cis between points a and b, then ac + — = ab

Answers: 1

Answer

You know the right answer?

Find the y-intercept of the function y=-2/3(x-1)+7....

Questions

Mathematics, 18.11.2020 05:10

Solve the given system of equations. - 3a = 36 10a + 3c = 9 2b + 50 = 23...

Mathematics, 18.11.2020 05:10

What is produced from Replication? Replicate the given DNA strands DNA: TCACGTGATCTAAAGGTGACAACT Replicate: DNA:...

Mathematics, 18.11.2020 05:10

X^2-7x+7y-y^2 Factor (pls explain)...

English, 18.11.2020 05:10

A room in Washington Square South. By the light of a candle, a young man in tousled hair and dressing gown is writing furiously at a little table. A c...

Physics, 18.11.2020 05:10

The force experienced by an electron in a field between parallel plates is proportional to which of the following? Select all that apply....

Mathematics, 18.11.2020 05:10

Emma also wonders how long it will take her balance of $300 to reach $450, assuming she doesn't make any payments toward it. Write the equation to re...

English, 18.11.2020 05:10

Which event in the rising action introduces a minor conflict that Kellan faces? Getting everything he wants confuses Kellan The robots be...

Mathematics, 18.11.2020 05:10

Your current CD matures in a few days. You would like to find an investment with a higher rate of return than the CD. Stocks historically have a rate...

History, 18.11.2020 05:10

What was the First Continental Congress? * 2 points British meeting to determine what to do about the crisis in Boston A meeting of...

History, 18.11.2020 05:10

What did Nebucandezzer do to be a strong ruler?...

Mathematics, 18.11.2020 05:10

An organization is considering having a "Bring your pet to work" day. The administration takes an SRS of 35 of their employees and finds that 20\% of...

Biology, 18.11.2020 05:10

2. How did the cessation of crossing-over contribute to the disparity between the X and Y chromosomes?...

History, 18.11.2020 05:10

Drunk people are crazy funny or is it just me ;0;...

Physics, 18.11.2020 05:10

A 10 kg bowling ball and a 1 kg softball are both dropped from rest from the same height at the same time. The force of gravity on the bowling ball...

English, 18.11.2020 05:10

What was unusual about the college when they moved there...

Mathematics, 18.11.2020 05:10

In August of 2012, Usain Bolt was named the fastest man in the world when he completed a 200-meter race in 19.32 seconds. Assuming he traveled at a co...

Biology, 18.11.2020 05:10

(50 POINTS) Fill in the table with the name of each phase of meiosis as shown in the diagram. Diagram # Phase of Meiosis 1. 2.

History, 18.11.2020 05:10

An apple, potato, and onion all taste the same if you eat them with your nose plugged...

Mathematics, 18.11.2020 05:10

Please give me the correct answer. ...

Mathematics, 18.11.2020 05:10

5. Fill in the missing statements and reasons in the proof. Given: AB≈DB and EB≈CB Prove: D≈A (4 points; 1 point each)

More questions: Mathematics Another questions