This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.
ATTTGCATACTACCGGGC
The red letters are the noncoding region, and the black letters are the protein coding region.
ATTAGCATACTACGGGC
ATTTGCATACTGACCGGGC
ATTTGCAATACTACCGGGC
ATTTGCAACTACCGGGC
ATGAATGCATACTACCGGGC
Answers: 1
Another question on Physics
Physics, 21.06.2019 17:20
When an object moves in uniform circular motion, the direction of its acceleration is a) in the same direction as its velocity vector. b) in the opposite direction of its velocity vector c) is directed toward the center of its circular path. d) is directed away from the center of its circular path. e) depends on the speed of the object.
Answers: 1
Physics, 22.06.2019 14:00
Agraduated cylinder contains 63.0 ml of water. a piece of gold, which has a density of 19.3 g/ cm3, is added to the water and the volume goes up to 64.5 ml. calculate the mass in grams of the gold that was added to the water. explain how you got your answer.
Answers: 3
Physics, 22.06.2019 18:30
Against his financial advisor's advice, frank has decided to invest his money in some risky stocks because he once made quite a bit of money in the stock market. his decision illustrates a. the representativeness heuristic b. overconfidence c. the availability heuristic d. confirmation bias select the best answer from the choices provided
Answers: 3
You know the right answer?
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the se...
Questions
Social Studies, 03.07.2019 08:30
Mathematics, 03.07.2019 08:30
English, 03.07.2019 08:30
Computers and Technology, 03.07.2019 08:30
Mathematics, 03.07.2019 08:30
Biology, 03.07.2019 08:30
Mathematics, 03.07.2019 08:30
History, 03.07.2019 08:30
Mathematics, 03.07.2019 08:30
Mathematics, 03.07.2019 08:30
