Questions and tasks in the category > 1598

History, 31.03.2020 04:28, miguelturner

Describe the government of Sudan and the challenges it is currently facing? Wut ish this type of question?...

English, 31.03.2020 04:28, july00

To form the masculine comparative adjective you add -ior to the base of the adjective...

Social Studies, 31.03.2020 04:28, jhosami46311

1. Why are measurements important?...

Mathematics, 31.03.2020 04:28, silas99

Identify the inverse g(x) of the given relation f(x). f(x) = {(8, 3), (4, 1), (0, -1), (-4, -3)}...

Spanish, 31.03.2020 04:28, walkerobrien5

Spanish 2 avancemos page 205 activity 7 (See picture)

Social Studies, 31.03.2020 04:28, dootdootkazoot

Forensic Anthropologists study the remains of deceased persons that the medicolegal (application of medical science and law) community has defined as...

Chemistry, 31.03.2020 04:28, ummitsjustjae

An electrode has a potential of 1.201 V with respect to a saturated silver-silver chloride electrode. What would the electrodes potential be relative...

Business, 31.03.2020 04:28, la200564

Funds acquired by the firm through retaining earnings have no cost because there are no dividend or interest payments associated with them, and no flo...

Physics, 31.03.2020 04:28, Paigex3

The deflection plates in an oscilloscope are 10 cm by 2 cm with a gap distance of 1 mm. A 100 volt potential difference is suddenly applied to the ini...

Mathematics, 31.03.2020 04:28, brookerebman15

Interpret the standardized residual. A. It is the spread of the sampling distribution that measures how the estimate varies from sample to sample of s...

Physics, 31.03.2020 04:28, shelliecurby

A projectile is fired horizontally from a gun that is 59.0 m above flat ground, emerging from the gun with a speed of 370 m/s. (a) How long does the p...

Business, 31.03.2020 04:28, ElizabethF

2. Why does the direction of an inter-company sale of inventory matter when the parent has a controlling interest in the subsidiary, but not when the...

Biology, 31.03.2020 04:28, Kittylover65

Base Sequence of Complementary DNA Strands: One strand of a double-helical DNA has the sequence (5’)GCGCAATATTTCTCAAAATATTGCGC(3’). a) Write the base...

Mathematics, 31.03.2020 04:27, markleal57151

What system of equations is shown by the graph plsss help I have no idea how to do this without a calculator and the teacher didn’t let us bring ours...

Chemistry, 31.03.2020 04:27, exiZT7535

A scuba tank has a volume 11.0 L. What volume of gas in liters at 0.950 atm required to completely fill the tank to a pressure of 45.0 atm, assuming n...

Physics, 31.03.2020 04:27, Adones7621

Intelligent beings in a distant galaxy send a signal to earth in the form of an electromagnetic wave. The frequency of the signal observed on earth is...

Business, 31.03.2020 04:27, jazmaine1217

As a result of __________, consumers do not remember all the information they see, read, or hear, even minutes after exposure to it. However, they rem...

Social Studies, 31.03.2020 04:27, KindaSmartPersonn

Igneous rocks are formed when...

Business, 31.03.2020 04:27, cheriebg

The aggregate-demand curve could shift from AD1 to AD2 as a result of a. an increase in government purchases. b. a decrease in net exports. c. househo...

Business, 31.03.2020 04:27, jules2629

On average, a book sells for $50. Variable selling expenses are $4 per book with the remaining selling expenses being fixed. The variable administrati...

Chemistry, 31.03.2020 04:27, baylabrown

ASAP I need help on the first question part a and b Plss draw it and take a photo

Physics, 31.03.2020 04:27, 2337911726

Find the angle of incidence at which a light beam traveling from a medium having the index of refraction n1 = 2.7 to another medium having the index o...

Computers and Technology, 31.03.2020 04:27, stacy021603

Create a program named SalesLetter whose Main() method uses severalWriteLine() calls to display a sales letter to prospective clients for a business o...

Chemistry, 31.03.2020 04:27, leo4687

If I were to add 3 moles of calcium hydroxide to excess aluminum phosphate how many moles of calcium phosphate would be produced...

Business, 31.03.2020 04:27, destyneedonnea

Ratios are useful for all of the following reasons, except: a. Ratios standardize numbers and facilitate comparisons b. Ratios are used to highlight w...

Biology, 31.03.2020 04:27, LikeIke7105

The graph ilustrate the activity level of three common digestive enzymes...

Mathematics, 31.03.2020 04:27, MadisonMayberry9650

An electronics shop picks every 10th customer to take part in a phone survey to determine their view of the service in the shop. Which sampling strate...

Physics, 31.03.2020 04:27, cedricevans41p4j3kx

A pentagon is a polygon with 5 sides of equal length. Imagine a pentagon in the xy-plane with its base (one of the 5 identical sides) extending from t...

History, 31.03.2020 04:27, kkmoney

Which action is an example of the principle of checks and balances? A. Members of Congress vote on a budget for the upcoming year. B...

Mathematics, 31.03.2020 04:27, needhelpasap8957

Which equation has a solution of x = 13? A. x+3= 10 B. x-10=3 C. 1 / 2 = 26 D.X+ 12 = 1...

Mathematics, 31.03.2020 04:27, annagracedavis2002

Click an item in the list or group of pictures at the bottom of the problem and, holding the button down, drag it into the correct position in the ans...

Mathematics, 31.03.2020 04:27, oofdiegoofdie5562

A worldwide organization of academics claims that the mean IQ score of its members is , with a standard deviation of . A randomly selected group of me...

Business, 31.03.2020 04:27, lcyaire

Which of the following statements is true concerning the distribution of safe payments? The distribution of safe payments assumes that any capital def...

Mathematics, 31.03.2020 04:27, joshxg227

8. Special Matrices a) If A and B are idempotent, is AB idempotent? Recall that A is idempotent if A2 = I Prove or give an example where it fails to b...

Mathematics, 31.03.2020 04:27, trin520

The shuttle bus from your parking lot and your office building operates on a 15 minute schedule. You arrive at the parking lot at a random time during...

Advanced Placement (AP), 31.03.2020 04:27, kayranicole1

Which of the following changes can take place in the long run? A.labor force b.machinery c. Technology. D. All of these can be changed in the long run...

Mathematics, 31.03.2020 04:27, janeou17xn

Use Newton's Method to approximate the zero(s) of the function. Continue the iterations until two successive approximations differ by less than 0.001....

Business, 31.03.2020 04:27, keenonwhite6801

An electronic store sells 3,000 HD TV sets every quarter of the year. Each TV set costs the store $ 270.00. The carrying cost is set at 2% of the purc...

Chemistry, 31.03.2020 04:27, crawford184232323234

The rate constant of a second-order reaction is 3.86 x 10−2 M-1 s-1. If the concentration of reactant A is 0.160 M after 75.6 sec, what was the initia...

Mathematics, 31.03.2020 04:27, deadlydazy13

A publisher reports that 42%42% of their readers own a particular make of car. A marketing executive wants to test the claim that the percentage is ac...

Business, 31.03.2020 04:27, Animallover100

As Mallory was shopping for groceries, she discovered that the store was out of Canada Dry Ginger Ale. As a result, she simply chose the store's priva...

Physics, 31.03.2020 04:27, Maxwell2539

A bungee jumper of mass 75kg is attached to a bungee cord of length L=35m. She walks oﬀ a platform (with no initial speed), reaches a height of 72m be...

Business, 31.03.2020 04:27, natalievick03

The Big Black Bird Company (BBBC) has a large order for special plastic-lined military uniforms to be used in an urgent military operation. Working th...

Business, 31.03.2020 04:27, reesespowerade

Jennifer Company has two products: A and B. The company uses activity-based costing. The estimated total cost and expected activity for each of the co...

Computers and Technology, 31.03.2020 04:27, CheddaDsk

Chapter 11 covers many concepts about Object Oriented Programming. For each of the sections of chapter 11, using MS-Word, give me an advantage of usin...

Business, 31.03.2020 04:27, Husky19

Trinity College sold season tickets for the 2019 football season for $400,000. A total of 8 games will be played during September, October and Novembe...

Social Studies, 31.03.2020 04:27, alexis9658

2. Why is it important to use units of measurement that are the same for everyone?...

Mathematics, 31.03.2020 04:27, lawanda90303

A multiple-choice test has 27 questions. Each question has 5 possible answers, of which only one is correct. What is the probability that sheer guessw...

Business, 31.03.2020 04:27, kaliyaht01

He constant dividend growth model: I. assumes that dividends increase at a constant rate forever. II. can be used to compute a stock price at any poin...

Biology, 31.03.2020 04:27, Jgrant500

As a NASA biologist, you are studying alien cells found under the polar ice cap of Mars. You find that these cells contain RNA consisting of 10 differ...

History, 31.03.2020 04:27, lizzyhearts

What government branch is better able to defend the rights of minority groups? Why?...

Physics, 31.03.2020 04:27, sativataurus

If you weigh 685 NN on the earth, what would be your weight on the surface of a neutron star that has the same mass as our sun and a diameter of 25.0...

Business, 31.03.2020 04:27, Maaaryyss

It is April 2018 and Mark is a novice investor who wants to decide between purchasing shares in EagleCorp or Myna Bird Inc. In fiscal year 2017, Eagle...

Mathematics, 31.03.2020 04:27, korban23

Please help and thank you...

Arts, 31.03.2020 04:27, kcwolford03

Which Is Your Favorite Song From Shawn Mendes Charlie Puth & Justin Bieber...

English, 31.03.2020 04:27, toot8255

Vhich of these sentences from the story reflects the theme that one's size is less important than one's spirit? A. "Large and tough as the lion...

Mathematics, 31.03.2020 04:27, cutegirl0987

Luis starts to do a division problem and notices that there is a pattern in the digits to the right of the decimal point.This number is...

Mathematics, 31.03.2020 04:27, moowalden1239

WILL MARK BRAINILESTWhich statements are true about the solution of 15 greater-than-or-equal-to 22 + x? Select three options. x greater-than-or-...

Mathematics, 31.03.2020 04:27, jacksonsmith0

Mark owns a cattle ranch near Hugo, Oklahoma. Mark is currently producing beef at an output level where marginal revenue exceeds marginal cost. In ord...

Social Studies, 31.03.2020 04:27, WorkingButNotReally

What did the French want to gain in the war?...

Business, 31.03.2020 04:27, britneyvaughn219

Probett Toy Company makes its own wind-up motors, which are then put into its toys. While the toy manufacturing process is continuous, the motors are...

Biology, 31.03.2020 04:27, shainaanderson24

"As you examine the specimens (slides, whole specimens, etc.) in lab, determine where each species belongs on the phylogenetic tree based on the trait...

Mathematics, 31.03.2020 04:27, genesisdiaz2562

A thin sheet of ice is in the form of a circle. If the ice is melting in such a way that the area of the sheet is decreasing at a rate of 0.5 m2/sec a...

Physics, 31.03.2020 04:26, rojina83

Which of the statements are true? please help me solve!!!

Arts, 31.03.2020 04:26, sydc1215

Which economic factor has helped in the growth of the food service industry?...

Social Studies, 31.03.2020 04:26, SmolBeanPotato

What did the French want to gain in the war?...

Mathematics, 31.03.2020 04:26, jasiyous21

Mens dress shoes sell for $59.95. Mr. Wilson bought two pairs of dress shoes. He gave the clerk 1 fifty dollar bill and 4 twenty dollar bills. How man...

History, 31.03.2020 04:26, robinsonchristopher0

Who was the Chief Justice of the supreme court who served for over 30 years in the earlier days of the US nation?...

Chemistry, 31.03.2020 04:26, Bloom247

Double displacement CaBr2 + K2SO3...

Mathematics, 31.03.2020 04:26, Jazzyyyy088888

A wall clock has a circumference of 43.96 inches. What is the area of the clock? (Use 3.14 for .)...

Physics, 31.03.2020 04:26, adriandehoyos1p3hpwc

9. Carrie wants to conduct a study on the socialization patterns among institutionalized schizophrenic patients. She would like to avoid interfering w...

Mathematics, 31.03.2020 04:26, Kenzijo33

What is the through each pair (19,-16) (-7,-15)...

Mathematics, 31.03.2020 04:26, Tori122367

For the graph of a function f(x,y) with coordinates (1, 3), (4,2), and (5, 7), which of the following describes the new coordinates given the transfor...

Business, 31.03.2020 04:26, myleefaustin

An automated assembly robot that cost $400,000 has a depreciable life of 5 years with a $100,000 salvage value. The MACRS depreciation rates for years...

English, 31.03.2020 04:26, laurenrubin18

The Argument that we should not use people merely as a means (from section 1.2 of Rachels book) is an attempt to show that a) we ought to transplant b...

Social Studies, 31.03.2020 04:26, TOLLYOISTHIS2774

Bud does not feel that he can leave for work each morning until he spends hours checking and rechecking to make sure that he has shut off all the appl...

Business, 31.03.2020 04:26, brookekolmetz

N the Baumol-Tobin model, if the nominal interest rate is 1%, the consumer's annual income is $36000, and every trip to the bank costs $20, then it is...

Chemistry, 31.03.2020 04:26, ybetancourt1

"Pure" rainfall (rainfall undisturbed by human influences) has a pH of approximately 5.6. The pH of rain in some areas has been measured at 2.6. The a...

Business, 31.03.2020 04:26, mmsomefood85

In deciding whether to drop its electronics product line, a company's manager should ignore ________. Group of answer choices the amount of unavoidabl...

Social Studies, 31.03.2020 04:26, elijahbravo2819

If a corrupt police officer is fired, the police force can ensure that officer is not hired by another community who does not know about his or her pa...

Mathematics, 31.03.2020 04:26, jerry7792

An article on polygraph testing of FBI agents indicated that the probability of a false-positive (a trustworthy person who nonetheless fails the test)...

Biology, 31.03.2020 04:26, mary9590

Which of the following statements regarding the flow of genetic information is false? Ribosomes function as factories that coordinate the functioning...

Business, 31.03.2020 04:26, lorelei7668

Reducto co. pays a weekly payroll of $97,000 that includes federal taxes withheld of 12,700 fica taxes withheld of 7260, and retirement withholdings o...

Mathematics, 31.03.2020 04:26, shelby8385

What is the positive x solution ?...

Business, 31.03.2020 04:26, antonio97

Public Imagination, Ltd. has an ROE of 16%, a plowback ratio of 75%, earnings for next year of $2 per share, and its stock has a required return of 18...

Mathematics, 31.03.2020 04:26, ayoismeisalex

The length of time T (in minutes) required to generate a human reaction to tear gas formula A has a gamma distribution with α = 2 and β = 4 minutes. T...

Mathematics, 31.03.2020 04:26, heyitsnott3rex

The slope of the line that passed through the points ( negative 24,m) & (12,11) is 1/12 . What is the value of m?...

Mathematics, 31.03.2020 04:26, Sambo2239

I have to prove that the left fraction equals the right fraction. How would i prove that for 37?

Mathematics, 31.03.2020 04:26, Jazzyyyy088888

What is true about FGH...

Biology, 31.03.2020 04:26, evanwall91

Why do viruses have either DNA or RNA as their own genetic information? -) A) DNA and RNA are not important in the process of living...

Biology, 31.03.2020 04:26, Alayna1037

Which of the following hereditary conditions is characterized by lack of insulin production? Group of answer choices Acne

Mathematics, 31.03.2020 04:26, jmwmarshall

What is 86x65=?Bc I don't know!...

Mathematics, 31.03.2020 04:26, sydneykated

Determine a simplified expression for the area of shaded region.

Mathematics, 31.03.2020 04:26, mangowammy

Ben says he can write three more equations because he knows 6 + 13 = 19. Is he right or wrong? Tell how you know....

Mathematics, 31.03.2020 04:26, michaelswagout

What is 826472894726283849X8363882939374647839292837463838 I’m so confused...

Mathematics, 31.03.2020 04:26, nananananananan03

Taryn is hosting a party at a restaurant. The restaurant is charging her $150 to rent the space and $18 per guest. If Taryn wants to spend less than $...

Chemistry, 31.03.2020 04:26, gesteban

How could automobiles and the use of roads create water pollution?...

Biology, 31.03.2020 04:26, ramireznoem1031

Which best describe the structure of DNA?...

Mathematics, 31.03.2020 04:26, Naara21

Are -1,0,1,2 infinite or finite numbers...

Spanish, 31.03.2020 04:26, hannahpalmario

Can someone help me with this Write it out in spanish Write a short email to your cousin in another country. Ask how she is doing, how her class...