brookealexis5768

since: 2019-02-11 05:18:18

Age: 27

About myself:

Profiles:

Asked questions: 3

Gave the right answers: 18

Points: 209

Best answer: 2

Questions

question

Biology, 22.01.2021 04:00

Theory that states all living things are made of cells, that they are the basic unit of structure and function, and new cells are produced from exisi...

question

Mathematics, 22.01.2021 04:00

Explain the meaning of zero in each situation. What is the opposite of the opposite of -12?...

question

Physics, 22.01.2021 04:00

If there is an outlier on your graph, you should ignore it. O True O False...

question

Chemistry, 22.01.2021 04:00

Why should the batteries be stored in the fridge when not being used?...

question

English, 22.01.2021 04:00

The heat was intense, and we were fatigued from the hike under the beating rays of the sun. Which vocabulary word goes with this sentence? deso...

question

History, 22.01.2021 04:00

Select the correct answer. What was the collective name for the four ancient sporting tournaments in Greece? O A. Olympic Gam...

question

Mathematics, 22.01.2021 04:00

The original cost of a comic book was $3.95. The store markup on the comic book was 20%. What is the store's price for the comic book?...

question

Mathematics, 22.01.2021 04:00

Sanjeep takes out a $250,000 mortgage. The yearly interest rate on the loan is 5% and the loan is for 25 years. Calculate the total amount of interest...

question

Mathematics, 22.01.2021 04:00

Which is the standard form of the equation of a parabola with a focus of (8,0) and directrix x = -8? y2 =-8 y2 = 8x y2 = 32x y = -3...

question

Biology, 22.01.2021 04:00

PLEASE HELP TIMED The host is calculating how many grams of limestone will be washed away by 30 kg of sulfur. He first converted kilograms to grams....

question

Mathematics, 22.01.2021 04:00

Select the correct answer from each drop-down menu. Joanne purchased a new computer for $1,700. She will need to pay $80 each month, Interest free, t...

question

Mathematics, 22.01.2021 04:00

Write an equation for a line perpendicular to y=-3x + 1 and passing through the point (6,-2)...

question

Mathematics, 22.01.2021 04:00

The missing exponent 1,728 =12 (?)...

question

Mathematics, 22.01.2021 04:00

What value of y would make {(-2, 18), (3, y), (6, 6), (-18, 2), (4, 9)} an inverse variation?...

question

Mathematics, 22.01.2021 04:00

Sin(x+22.5)=cos(x-16.5) what is the value of x?...

question

Mathematics, 22.01.2021 04:00

- Think Critically Oxygen-16 and oxygen- 17 are isotopes of oxygen. The numbers 16 and 17 represent their mass numbers, respectively. If...

question

Mathematics, 22.01.2021 04:00

Find the value of a. Hint: Draw in the altitude. Pls explain your answers. Thanks in Advance!

question

Mathematics, 22.01.2021 04:00

5 people went to the store. Each bought a candy bar for $1.50 and an orange for x dollars. When they were finished they spent $10.80...

question

Biology, 22.01.2021 04:00

2 DNA: TTTACGGCCATCAGGCAATACTGG mRNA: Codon: Anitcodon: Amino Acids:...

question

English, 22.01.2021 04:00

PLS HELP !! WORTH 67 POINTS AND I WILL MARK BRAINLIEST ! THIS IS DUE 11:59PM !! Directions: As you read "The Case Against High School Sports," identi...